DESAIN PRIMER PCR SECARA IN SILICO UNTUK AMPLIFIKASI GEN COI PADA KUPU-KUPU Papilio ulysses Linnaeus DARI PULAU BACAN

Jurnal Pendidikan Matematika dan IPA

View Publication Info
 
 
Field Value
 
Title DESAIN PRIMER PCR SECARA IN SILICO UNTUK AMPLIFIKASI GEN COI PADA KUPU-KUPU Papilio ulysses Linnaeus DARI PULAU BACAN
 
Creator Suparman, Suparman
 
Description The insillico research was conducted to produce primer sequence of COI gene in Butterfly species Papilio ulyses from Bacan Island that will be used in gene isolation. The COI sub-unit I is a barcode gene that generally have special purposes in animal identification. It is also available in phyilogenetic analysis. The first step of method is downloading the COI DNA sequence of Papilio ulysses from GeneBank (NCBI). Then the conserve region of COI sequence is identified to determine primer. Primer is designed with primer designer software (Genamics Expression) in two direction of DNA reading frame that are : forward primer (COI Pu-F) and reverse primer (COI Pu-R). The last step is primer confirmation with primer blast tool in NCBI. Primers of COI gene that are produced consist of two, that are CGAAAATGACTTTATTCAACA for forward primer (COI Pu-R) and AGCAGTAATTCCAACAGCTC for reverse primer (COI Pu-R). The optimal temperature of annealing is from 50,740 to 55,740 Celsius with PCR product around 567 base pair long. Key Words : PCR primer, in silico, COI gene, Papilio ulysses, Bacan island.
 
Publisher Universitas Tanjungpura
 
Contributor
 
Date 2016-11-02
 
Type info:eu-repo/semantics/article
info:eu-repo/semantics/publishedVersion
Peer-reviewed Article
 
Format application/pdf
 
Identifier http://jurnal.untan.ac.id/index.php/PMP/article/view/17341
10.26418/jpmipa.v7i1.17341
 
Source Jurnal Pendidikan Matematika dan IPA; Vol 7, No 1 (2016): Januari 2016; 14-24
2579-7530
2086-0234
10.26418/jpmipa.v7i1
 
Language eng
 
Relation http://jurnal.untan.ac.id/index.php/PMP/article/view/17341/14790
 
Rights Copyright (c) 2018 Jurnal Pendidikan Matematika dan IPA
 

Contact Us

The PKP Index is an initiative of the Public Knowledge Project.

For PKP Publishing Services please use the PKP|PS contact form.

For support with PKP software we encourage users to consult our wiki for documentation and search our support forums.

For any other correspondence feel free to contact us using the PKP contact form.

Find Us

Twitter

Copyright © 2015-2018 Simon Fraser University Library